chrna9

Ensembl ID:
ENSDARG00000054680
ZFIN ID:
ZDB-GENE-090312-63
Human Orthologue:
CHRNA9
Human Description:
cholinergic receptor, nicotinic, alpha 9 [Source:HGNC Symbol;Acc:14079]
Mouse Orthologue:
Chrna9
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:1202403]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32671 Nonsense Available for shipment Available now
sa975 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077335 Nonsense 117 515 3 7
ENSDART00000140706 Nonsense 102 548 3 5
Genomic Location (Zv9):
Chromosome 1 (position 22186680)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22721847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGGAGGACTCCTCAGGACCCCCAGACACTAATGTGGTGTTGAGATA[T/A]AATGGTGAGATCACATGGGACTCCCCTGCCATCACCAAGAGTTCTTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077335 Nonsense 280 515 5 7
ENSDART00000140706 Nonsense 265 548 5 5
Genomic Location (Zv9):
Chromosome 1 (position 22190803)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22725970
KASP Assay ID:
554-0880.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCTTCTTTGTTATTTGTTTCTTGTTTTGTGTTTCTTAYAGGAAAATA[T/G]TACATTGCAACAATGACCATGATAACAGCCTCTACATCTTTGACTATATT
Associated Phenotype:
Data not yet available

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link