adra2db

Ensembl ID:
ENSDARG00000054667
ZFIN ID:
ZDB-GENE-021010-5
Description:
Alpha-2Db adrenergic receptor [Source:UniProtKB/Swiss-Prot;Acc:Q8JG69]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12287 Nonsense Available for shipment Available now
sa10540 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076903 Nonsense 205 415 1 1
Genomic Location:
Chromosome 21 (position 31588060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTTCCTCCTGTATCGTGTCGTTTTTTGCACCGGGTCTTATTATGATTT[T/A]GGTGTACTGCAGGATCTACAGGGTRGCCAAACAGCGCGCGTCCACTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10540
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076903 Nonsense 351 415 1 1
Genomic Location:
Chromosome 21 (position 31588499)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTTCACCTTCGTGCTGGCGGTGGTGATGGGGGTGTTCGTGCTCTGCTG[G/A]TTTCCTTTCTTCTTCACCTACAGCCTTCACGCCATATGCCGAAAAAGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/byw4iq93