CD22 (21 of 32)

Ensembl ID:
ENSDARG00000054655
Description:
CD22 molecule [Source:HGNC Symbol;Acc:1643]
Human Orthologue:
CD22
Human Description:
CD22 molecule [Source:HGNC Symbol;Acc:1643]
Mouse Orthologue:
Cd22
Mouse Description:
CD22 antigen Gene [Source:MGI Symbol;Acc:MGI:88322]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38302 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38302
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099106   None 295 None 3
ENSDART00000129527 Nonsense 291 385 4 5
Genomic Location (Zv9):
Chromosome 1 (position 57379054)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56114158
GRCz10 1 56371856
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTGATGACAGTGGAGAATACAAGTGTAGAGCCAGAAATGCACATGGA[G/T]AGAAATACTCTGATCCTGTGACTTTAGATGTCCAGTGTGAGTTTAAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link