Q08CH4_DANRE

Ensembl ID:
ENSDARG00000054645
Description:
LOC568811 protein [Source:UniProtKB/TrEMBL;Acc:A3KNY2]
Human Orthologue:
PACSIN3
Human Description:
protein kinase C and casein kinase substrate in neurons 3 [Source:HGNC Symbol;Acc:8572]
Mouse Orthologue:
Pacsin3
Mouse Description:
protein kinase C and casein kinase substrate in neurons 3 Gene [Source:MGI Symbol;Acc:MGI:1891410]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20032 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000055388 Essential Splice Site 303 315 None 8
ENSDART00000124504 Essential Splice Site 303 389 None 9
Genomic Location (Zv9):
Chromosome 3 (position 30819955)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 30537994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCACATTTACTCCTTCACTCACCCTGTCTTTTGCTCTCTTTCTATTTC[A/T]GGAGTGGACTCCAGACAAGAAGCATAAAAAAGGAAAGAAGGAGGTGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link