fli1a

Ensembl ID:
ENSDARG00000054632
ZFIN ID:
ZDB-GENE-980526-426
Description:
Friend leukemia integration 1 transcription factor [Source:RefSeq peptide;Acc:NP_571423]
Human Orthologue:
FLI1
Human Description:
Friend leukemia virus integration 1 [Source:HGNC Symbol;Acc:3749]
Mouse Orthologue:
Fli1
Mouse Description:
Friend leukemia integration 1 Gene [Source:MGI Symbol;Acc:MGI:95554]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43180 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041354 Nonsense 421 450 10 10
ENSDART00000076861 Nonsense 422 451 9 9
ENSDART00000098459   None 200 9 9
ENSDART00000134817   None 212 None 6
ENSDART00000137978   None 123 None 4
ENSDART00000147074   None 200 None 4
Genomic Location (Zv9):
Chromosome 18 (position 47049926)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 48491617
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAATGCCCGTCACCTCCTCCAACTTCTTCGGTCCCACAACCCCATACT[G/A]GAGCTCCCCACCAGGAGGTATTTACCCCAATCCCAGCGTCCCACGCCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Rheumatoid arthritis: Meta-analysis identifies nine new loci associated with rheumatoid arthritis in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link