fli1a

Ensembl ID:
ENSDARG00000054632
ZFIN ID:
ZDB-GENE-980526-426
Description:
Friend leukemia integration 1 transcription factor [Source:RefSeq peptide;Acc:NP_571423]
Human Orthologue:
FLI1
Human Description:
Friend leukemia virus integration 1 [Source:HGNC Symbol;Acc:3749]
Mouse Orthologue:
Fli1
Mouse Description:
Friend leukemia integration 1 Gene [Source:MGI Symbol;Acc:MGI:95554]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4770 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041354 Essential Splice Site 127 450 None 10
ENSDART00000076861 Essential Splice Site 128 451 None 9
ENSDART00000098459 Essential Splice Site 152 200 None 9
ENSDART00000134817 None 86 212 2 6
ENSDART00000137978 Essential Splice Site 95 123 None 4
ENSDART00000147074 Essential Splice Site 152 200 None 4
Genomic Location:
Chromosome 18 (position 47010759)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGCCTCCAAACATGACGACCAATGAGAGGAGAGTCATCGTCCCCGCAGG[T/C]GAATACTGCATAAGTATGTTTAAATGAGAATTCGAATGMTGTRTTAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Myopia (pathological): A genome-wide association study provides evidence for association of chromosome 8p23 (MYP10) and 10q21.1 (MYP15) with high myopia in the French Population. (View Study)
  • Rheumatoid arthritis: Meta-analysis identifies nine new loci associated with rheumatoid arthritis in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1hyq2d10