fras1

Ensembl ID:
ENSDARG00000054619
ZFIN ID:
ZDB-GENE-060526-68
Description:
extracellular matrix protein FRAS1 [Source:RefSeq peptide;Acc:NP_001124312]
Human Orthologue:
FRAS1
Human Description:
Fraser syndrome 1 [Source:HGNC Symbol;Acc:19185]
Mouse Orthologue:
Fras1
Mouse Description:
Fraser syndrome 1 homolog (human) Gene [Source:MGI Symbol;Acc:MGI:2385368]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5312 Nonsense Mutation detected in F1 DNA During 2016
sa33662 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17510 Nonsense Available for shipment Available now
sa40517 Nonsense Mutation detected in F1 DNA During 2016
sa26535 Nonsense Mutation detected in F1 DNA During 2016
sa20491 Nonsense Mutation detected in F1 DNA During 2016
sa33663 Nonsense Mutation detected in F1 DNA During 2016
sa2278 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2268 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33664 Nonsense Mutation detected in F1 DNA During 2016
sa14516 Nonsense Available for shipment Available now
sa20492 Nonsense Mutation detected in F1 DNA During 2016
sa20493 Nonsense Mutation detected in F1 DNA During 2016
sa25308 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 268 3970 8 72
ENSDART00000097856 Nonsense 248 3989 8 74
ENSDART00000137112 Nonsense 234 3936 7 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40529423)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGAATGCATGATATGTTGTGTTCTCCTCAGGGTCAGACGAAGGTCAAG[C/T]GAGCCGRCCAGTGCTGTGAAGACTGTGCCACATCTAAAGGCAGCTGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845   None 3970 None 72
ENSDART00000097856 Essential Splice Site 347 3989 10 74
ENSDART00000137112   None 3936 None 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40535658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTGTCCATTTAGGGGCAGAAAGCCATCAAGAGTTTTAGACGTCTCTCT[G/T]TAAGTAAACATAAACATGGTTTGCAAGATCAATAGACTCTGTTAAATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 537 3970 14 72
ENSDART00000097856 Nonsense 548 3989 15 74
ENSDART00000137112 Nonsense 503 3936 13 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40557425)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATTTGATTTATTTATTTGTAGCTTGTGACCCTTCCTGTGCAACCTGC[C/T]AACCTGACAGCCCCAGCTGTATGAGCTGCCCTGCAGAACAWGCACTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 543 3970 14 72
ENSDART00000097856 Nonsense 554 3989 15 74
ENSDART00000137112 Nonsense 509 3936 13 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40557445)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAGCTTGTGACCCTTCCTGTGCAACCTGCCAACCTGACAGCCCCAGCTG[T/A]ATGAGCTGCCCTGCAGAACATGCACTGCATCAAGGGAAATGTGCACCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26535
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 1265 3970 27 72
ENSDART00000097856 Nonsense 1278 3989 28 74
ENSDART00000137112 Nonsense 1231 3936 26 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40603025)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGCGAGCAGCTGCAGTATGTTCATGATCGTTCAGATGGAGACCAGGAC[A/T]GACTTCTGCTGCAGGTCAATGACGGACACAGCTACCAGAACGTCCTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 1394 3970 29 72
ENSDART00000097856 Nonsense 1406 3989 31 74
ENSDART00000137112 Nonsense 1360 3936 28 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40613255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTAAATGAAGGCACTGTCTGGTACCGACATTATGGATCTGGAACACAG[A/T]GAGACACTTTTCAGTTTCAGGTGAGACATGAATAGATTTAACCCAAGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 1588 3970 35 72
ENSDART00000097856 Nonsense 1600 3989 37 74
ENSDART00000137112 Nonsense 1554 3936 34 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40626258)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACTTGTCTCCATACTGTGTAGGTGTGCAACAGTTGGCAGTAACAGATT[C/A]AGACACGGCCCCTGAAGAGCTGGAGTTTGAGGTGGTGGAGGGACCACTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2278
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Essential Splice Site 2055 3970 42 72
ENSDART00000097856 Essential Splice Site 2067 3989 44 74
ENSDART00000137112 Essential Splice Site 2021 3936 41 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40636301)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARAGAAGGCCCTAGAGTAACAATCAACAGAGGACTGCAGCTCGCAGCAG[G/T]TTAGGAGACAGTTACATTAGCTTGGCATCTGCTTACTGATTGATTGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Essential Splice Site 2219 3970 46 72
ENSDART00000097856 Essential Splice Site 2231 3989 48 74
ENSDART00000137112 Essential Splice Site 2185 3936 45 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40643319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGAAATGGTAGCCTGCCTGGAGAGTTGCACAATATGTGATGTTGTTGC[A/G]GGAACACGGATCAGCTCRTTTACCCAGGCTGACCTGGCCTCTCGCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 2331 3970 48 72
ENSDART00000097856 Nonsense 2350 3989 50 74
ENSDART00000137112 Nonsense 2297 3936 47 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40651625)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTGTTCAGGCACCTCGTCATGGGACCATCGAGCGCACCAGTAATGGT[C/T]AGCATTATCGTCAGACAAACACCTTCACTATGGACGACGTCTACCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 3010 3970 59 72
ENSDART00000097856 Nonsense 3029 3989 61 74
ENSDART00000137112 Nonsense 2976 3936 58 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40666717)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAAAAACAGTGCATGTCCTGCTTTTCAGCACCTACGATCGAGTTTGAA[C/T]AAGCCACATATCAAGTTCGTGAGCCACCTGGTCCCGATGGCATTGAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20492
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 3691 3970 70 72
ENSDART00000097856 Nonsense 3710 3989 72 74
ENSDART00000137112 Nonsense 3657 3936 69 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40683477)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAACCTGAATTCAGCCTACAAGCTGCAGCTGGAGAAAGTGTATTTGTG[T/A]ACGGGACGGGATGGATATGTTCCCTTCTTTGACCCTACAGGCACACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 3810 3970 72 72
ENSDART00000097856 Nonsense 3829 3989 74 74
ENSDART00000137112 Nonsense 3776 3936 71 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40685554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGACCCGAGTCTATTTCGTCTCCCAGAATCCAGCGCTCAGTGACTTA[T/A]GAGCTGAAGCGAAGCCGCCGAGATCTAGTAGACCGATCAGGTCGCCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076845 Nonsense 3830 3970 72 72
ENSDART00000097856 Nonsense 3849 3989 74 74
ENSDART00000137112 Nonsense 3796 3936 71 71

The following transcripts of ENSDARG00000054619 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40685612)
KASP Assay ID:
554-7507.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGAAGCCGCCGAGATCTAGTAGACCGATCAGGTCGCCTAATGCTTGAT[G/T]AATCATTGATCTACGACAATGAAGGTGACCAGGTAAAGAATGGCACCAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hair morphology: Common variants in the trichohyalin gene are associated with straight hair in Europeans. (View Study)
  • Uric acid levels: A genome wide association study of plasma uric acid levels in obese cases and never-overweight controls. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link