cnot6l

Ensembl ID:
ENSDARG00000054597
ZFIN ID:
ZDB-GENE-050522-302
Description:
CCR4-NOT transcription complex subunit 6-like [Source:UniProtKB/Swiss-Prot;Acc:A2BHJ4]
Human Orthologue:
CNOT6L
Human Description:
CCR4-NOT transcription complex, subunit 6-like [Source:HGNC Symbol;Acc:18042]
Mouse Orthologue:
Cnot6l
Mouse Description:
CCR4-NOT transcription complex, subunit 6-like Gene [Source:MGI Symbol;Acc:MGI:2443154]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16674 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16674
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076807 Nonsense 6 559 2 13

The following transcripts of ENSDARG00000054597 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 40420485)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTTTCTGCATGGATCTCCAGATTAACAGGCATGCCAAAGGAAAAATA[T/A]GATCCTCCAGACCCACGCAGATTATACACCAWCATGTCAGCCGAGGAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/svrw76xd