LOC100002134

Ensembl ID:
ENSDARG00000054584
Human Orthologues:
SLC30A10, SLC30A2, SLC30A3, SLC30A4, SLC30A8
Human Descriptions:
solute carrier family 30 (zinc transporter), member 2 [Source:HGNC Symbol;Acc:11013]
solute carrier family 30 (zinc transporter), member 3 [Source:HGNC Symbol;Acc:11014]
solute carrier family 30 (zinc transporter), member 4 [Source:HGNC Symbol;Acc:11015]
solute carrier family 30 (zinc transporter), member 8 [Source:HGNC Symbol;Acc:20303]
solute carrier family 30, member 10 [Source:HGNC Symbol;Acc:25355]
Mouse Orthologues:
Slc30a10, Slc30a2, Slc30a3, Slc30a4, Slc30a8
Mouse Descriptions:
solute carrier family 30 (zinc transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:106637]
solute carrier family 30 (zinc transporter), member 3 Gene [Source:MGI Symbol;Acc:MGI:1345280]
solute carrier family 30 (zinc transporter), member 4 Gene [Source:MGI Symbol;Acc:MGI:1345282]
solute carrier family 30 (zinc transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI:2442682]
solute carrier family 30, member 10 Gene [Source:MGI Symbol;Acc:MGI:2685058]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6536 Essential Splice Site Mutation detected in F1 DNA During 2014
sa4771 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076803 Essential Splice Site 228 462 3 3
Genomic Location:
Chromosome 18 (position 47801370)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAKTTCTGCGTGAACTAACCCCCCTTTATTGTRCTTATTTGTWACCTGCC[A/T]GCACCTCAGTGTGTTYCCCAAGTCTCYATCTTCMGAGWGCATCATCTGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4771
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076803 Nonsense 326 462 3 3
Genomic Location:
Chromosome 18 (position 47801665)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTGCTGGTYCTCCAGGCGGCGCCTCTGCATCTTTCTGTCCGCCAGGTG[C/T]GACTCTGTCTCGGTCAAGTTCCCGGAGTATTATCGGTCCACGAACTTCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ui99wf1o