mfsd6b

Ensembl ID:
ENSDARG00000054583
ZFIN ID:
ZDB-GENE-040912-84
Description:
Major facilitator superfamily domain-containing protein 6-B [Source:UniProtKB/Swiss-Prot;Acc:B0UYT5]
Human Orthologue:
MFSD6
Human Description:
major facilitator superfamily domain containing 6 [Source:HGNC Symbol;Acc:24711]
Mouse Orthologue:
Mfsd6
Mouse Description:
major facilitator superfamily domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1922925]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21555 Nonsense Mutation detected in F1 DNA During 2014
sa10516 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004544 Nonsense 131 747 1 6
ENSDART00000076815 Nonsense 135 412 3 4
ENSDART00000135821 Nonsense 131 747 2 7
Genomic Location:
Chromosome 9 (position 42578276)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTACAAACTATACGCATGCTGGTAATCATACCAGACAGCGAAGATACT[T/A]GACTGAGGATGCATACGCCAATCCTCCACTTTCTCAGCCCATTTTAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004544 Nonsense 157 747 1 6
ENSDART00000076815 Nonsense 161 412 3 4
ENSDART00000135821 Nonsense 157 747 2 7
Genomic Location:
Chromosome 9 (position 42578199)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTCTCAGCCCATTTTAGCTGCATACAGACCTCACTCTAGATATATT[C/T]GAAGTGCAAATACAAAYACCACAAGCGCTCCTTTTAGAAACTCAACWGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/szzeoghv