mfsd6b

Ensembl ID:
ENSDARG00000054583
ZFIN ID:
ZDB-GENE-040912-84
Description:
Major facilitator superfamily domain-containing protein 6-B [Source:UniProtKB/Swiss-Prot;Acc:B0UYT5]
Human Orthologue:
MFSD6
Human Description:
major facilitator superfamily domain containing 6 [Source:HGNC Symbol;Acc:24711]
Mouse Orthologue:
Mfsd6
Mouse Description:
major facilitator superfamily domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1922925]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21555 Nonsense Mutation detected in F1 DNA During 2016
sa10516 Nonsense Available for shipment Available now
sa41504 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004544 Nonsense 131 747 1 6
ENSDART00000076815 Nonsense 135 412 3 4
ENSDART00000135821 Nonsense 131 747 2 7
Genomic Location (Zv9):
Chromosome 9 (position 42578276)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41703446
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTACAAACTATACGCATGCTGGTAATCATACCAGACAGCGAAGATACT[T/A]GACTGAGGATGCATACGCCAATCCTCCACTTTCTCAGCCCATTTTAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004544 Nonsense 157 747 1 6
ENSDART00000076815 Nonsense 161 412 3 4
ENSDART00000135821 Nonsense 157 747 2 7
Genomic Location (Zv9):
Chromosome 9 (position 42578199)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41703369
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTTTCTCAGCCCATTTTAGCTGCATACAGACCTCACTCTAGATATATT[C/T]GAAGTGCAAATACAAAYACCACAAGCGCTCCTTTTAGAAACTCAACWGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004544 Nonsense 181 747 1 6
ENSDART00000076815 Nonsense 185 412 3 4
ENSDART00000135821 Nonsense 181 747 2 7
Genomic Location (Zv9):
Chromosome 9 (position 42578126)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 41703296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCGCTCCTTTTAGAAACTCAACAGTGGACATCAGTATGGCATCAAACT[T/G]AACAACGATGTCACCCAGTGCCACAAAAGTCCCATTGAAATCTACCTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link