ENSDARG00000054572

Ensembl ID:
ENSDARG00000054572
Mouse Orthologue:
4930434E21Rik
Mouse Description:
RIKEN cDNA 4930434E21 gene Gene [Source:MGI Symbol;Acc:MGI:1923042]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35926 Nonsense Mutation detected in F1 DNA During 2016
sa24991 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076793 Nonsense 48 515 2 18
Genomic Location:
Chromosome 15 (position 30842763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCAACAGGGATTTTGAAAGGTCACTCCGCCCCTGTTGCCTACGTCTG[T/A]GTCACGTCAGAGAATGGACACATTTACTCAGTGTCCACAGACAACACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076793 Essential Splice Site 67 515 3 18
Genomic Location:
Chromosome 15 (position 30846913)
KASP Assay ID:
554-7337.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAACATAAATATGAAAACGTATGATTTTTTTATCATGCTTTTTTTTC[A/T]GATATGGCATATAAAGGACCAGACGTGTCTGTTTACTGCACATCCAAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link