A7MC21_DANRE

Ensembl ID:
ENSDARG00000054548
Description:
LOC562362 protein [Source:UniProtKB/TrEMBL;Acc:A7MC21]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13362 Nonsense Available for shipment Available now
sa8482 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7255 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076761 Nonsense 164 260 3 4
Genomic Location:
Chromosome 23 (position 43925429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTCTTCACCAGAGGAGATGATCTAAAGAASAAGACCATTGAAGAGTA[T/A]CTGGGTGCACCTGGATCTGCTCTAATGARCCTCATTGAACAGTGTGGARA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8482
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076761 Essential Splice Site 258 260 3 4
ENSDART00000076761 Essential Splice Site 258 260 3 4
Genomic Location:
Chromosome 23 (position 43925713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAAAGAGAAARATGAACTYATTTCCAAACATGAAGAAGAGAAARAAA[G/A]WATAAAGATGAAGATGGAGGAAGAAAAAAAGRCACTTCAAWATAAATTYC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076761 Essential Splice Site 258 260 3 4
ENSDART00000076761 Essential Splice Site 258 260 3 4
Genomic Location:
Chromosome 23 (position 43925713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAAAAGAGAAARATGAACTYATTTCCAAACATGAAGAAGAGAAARAAA[G/A]WATAAAGATGAAGATGGAGGAAGAAAAAAAGRCACTTCAAWATAAATTYC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jy6ogta8