samsn1a

Ensembl ID:
ENSDARG00000054543
ZFIN ID:
ZDB-GENE-030131-8639
Description:
SAM domain, SH3 domain and nuclear localisation signals, 1a [Source:RefSeq peptide;Acc:NP_001122141
Human Orthologue:
SAMSN1
Human Description:
SAM domain, SH3 domain and nuclear localization signals 1 [Source:HGNC Symbol;Acc:10528]
Mouse Orthologue:
Samsn1
Mouse Description:
SAM domain, SH3 domain and nuclear localization signals, 1 Gene [Source:MGI Symbol;Acc:MGI:1914992]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17145 Essential Splice Site Available for shipment Available now
sa2821 Nonsense F2 line generated During 2017
sa7235 Nonsense Mutation detected in F1 DNA During 2017
sa28476 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Essential Splice Site 112 621 6 16
ENSDART00000099947   None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28928297)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29646327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GWTGCACAGTGACATTTRAAAACTAAATAGGTCRAATRTGTTTGCATTTC[A/T]GATCTGAGGAGAGCTGTAAGGACAGAAAACCAGACAATGGCAAACTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2821
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947   None 333 None 8
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947   None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28925646)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29643676
KASP Assay ID:
554-3317.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGATCCTAGTAAAGGTGCCAAAGGAACGATGCCTGATGTAGGGATGTG[G/A]TCACAAAATCCGGATATATCTTGTACCTCTGAAGGTTTGAGGGTCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947   None 333 None 8
ENSDART00000076749 Nonsense 213 621 9 16
ENSDART00000099947   None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28925646)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29643676
KASP Assay ID:
554-3317.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGATYCTAGTAAAGGTGCCAAAGGAACGATGCCTGATGTWGGGATGTG[G/A]TCACAAAATCCGGATATATCTTGTACCTCTGAAGGTTTGAGGGTCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076749 Nonsense 287 621 9 16
ENSDART00000099947   None 333 None 8
Genomic Location (Zv9):
Chromosome 15 (position 28925426)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29643456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCAGAAACAGGAGTCAAGGAGACAAAATCAATGGCCCAAATATGAAG[A/T]GAGACTCCTTGCCCAAAGGAATGATGCGCTCCACGACCAGTGTAGATTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link