
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ACOT12
- Ensembl ID:
- ENSDARG00000054534
- Description:
- acyl-CoA thioesterase 12 [Source:HGNC Symbol;Acc:24436]
- Human Orthologue:
- ACOT12
- Human Description:
- acyl-CoA thioesterase 12 [Source:HGNC Symbol;Acc:24436]
- Mouse Orthologue:
- Acot12
- Mouse Description:
- acyl-CoA thioesterase 12 Gene [Source:MGI Symbol;Acc:MGI:1921406]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9440 | Essential Splice Site | Available for shipment | Available now |
sa34983 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa9440
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076731 | Essential Splice Site | 236 | 570 | 6 | 15 |
- Genomic Location (Zv9):
- Chromosome 10 (position 44279026)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 43085052 GRCz11 10 42913432 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGAGGRCAGATCATGGCCTGGATGGAGAATGTAGCTACAGTAGCAGCCAG[G/A]TATCAGATACACCTGCAARATGCATCATTAGCTGCACAACAACCCCATCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34983
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000076731 | Essential Splice Site | 439 | 570 | 12 | 15 |
- Genomic Location (Zv9):
- Chromosome 10 (position 44275341)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 43081367 GRCz11 10 42909747 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCATGCTCGCCGACCTGCAGCTACGGCCACAGTGGGACAAAAACTACCTG[T/C]AGGAGAACAAGAGATTGCGGTTTATGAGTGCAAAAACACTTCAAATTGAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: