araf

Ensembl ID:
ENSDARG00000054533
ZFIN ID:
ZDB-GENE-050102-2
Description:
serine/threonine-protein kinase A-Raf [Source:RefSeq peptide;Acc:NP_991306]
Human Orthologue:
ARAF
Human Description:
v-raf murine sarcoma 3611 viral oncogene homolog [Source:HGNC Symbol;Acc:646]
Mouse Orthologue:
Araf
Mouse Description:
v-raf murine sarcoma 3611 viral oncogene homolog Gene [Source:MGI Symbol;Acc:MGI:88065]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13556 Nonsense Available for shipment Available now
sa18801 Nonsense Mutation detected in F1 DNA During 2014
sa20425 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076687 Nonsense 46 605 2 17
ENSDART00000076696 Nonsense 46 604 2 17
ENSDART00000136342 Nonsense 46 265 2 6
ENSDART00000138182 Nonsense 46 608 2 15
ENSDART00000140081 Nonsense 46 604 2 15
Genomic Location:
Chromosome 5 (position 28501153)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCATCTTTGATTATGTTCAGGYAAACGTTCGGCCTGGGCAAACTGTGTA[T/G]GATAGTTTAGATAAAGCCCTAAAAGTCMGWGGCCTAAGCCARGATTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076687 Nonsense 171 605 5 17
ENSDART00000076696 Nonsense 171 604 5 17
ENSDART00000136342 Nonsense 171 265 5 6
ENSDART00000138182 Nonsense 171 608 5 15
ENSDART00000140081 Nonsense 171 604 5 15
Genomic Location:
Chromosome 5 (position 28502432)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGTCAGGTGTGTTAATAATACAGAAGACTGCCCTGCGATATTGATATA[T/A]CCGGCCACCAATTCCATATCGCAGAGCGACCTACCTTTAACCTCAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076687 None None 605 None 17
ENSDART00000076696 None None 604 None 17
ENSDART00000136342 Nonsense 263 265 6 6
ENSDART00000138182 None None 608 None 15
ENSDART00000140081 None None 604 None 15
Genomic Location:
Chromosome 5 (position 28502798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCCACATCTCTTGATGTTCTCTCATTTTGACATTGTTTTAAAGGAA[C/T]AGTTCGCTTAAACATTATAGTCACTCTCAATGTTTTCTACTAAATCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/26qzzpow