rars

Ensembl ID:
ENSDARG00000054530
ZFIN ID:
ZDB-GENE-030131-9014
Description:
arginyl-tRNA synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_956342]
Human Orthologue:
RARS
Human Description:
arginyl-tRNA synthetase [Source:HGNC Symbol;Acc:9870]
Mouse Orthologue:
Rars
Mouse Description:
arginyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1914297]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12145 Nonsense Available for shipment Available now
sa25165 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076729 Nonsense 151 661 4 15
ENSDART00000130626 Nonsense 151 661 4 15
ENSDART00000132743 Nonsense 149 273 4 7
ENSDART00000136211 Nonsense 146 229 3 5
ENSDART00000145191 Nonsense 85 128 4 5

The following transcripts of ENSDARG00000054530 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 34300763)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCAGAGAGATCGCAGAGAAKATCGTCCAAAACATTCCCAACAATGACT[T/A]RATTGAAAAAACTGAAATTGCTGGGCCAGGTATAGTTTCAGAACACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076729 Essential Splice Site 275 661 7 15
ENSDART00000130626 Essential Splice Site 275 661 7 15
ENSDART00000132743 None 273 273 7 7
ENSDART00000136211 None None 229 None 5
ENSDART00000145191 None None 128 None 5

The following transcripts of ENSDARG00000054530 do not overlap with this mutation:

Genomic Location:
Chromosome 21 (position 34305724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATCTCAGTGTGTCTCCACCTATTGGTGACCTTCAGGCTTTCTACAAA[G/T]TGAGTATCTGTTAAATTCAAAACAATTGTTTAACCTAAACTTGGTGGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6p7tv10d