rars

Ensembl ID:
ENSDARG00000054530
ZFIN ID:
ZDB-GENE-030131-9014
Description:
arginyl-tRNA synthetase, cytoplasmic [Source:RefSeq peptide;Acc:NP_956342]
Human Orthologue:
RARS
Human Description:
arginyl-tRNA synthetase [Source:HGNC Symbol;Acc:9870]
Mouse Orthologue:
Rars
Mouse Description:
arginyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:1914297]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43687 Nonsense Mutation detected in F1 DNA During 2016
sa43688 Nonsense Mutation detected in F1 DNA During 2016
sa12145 Nonsense Available for shipment Available now
sa25165 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076729 Nonsense 115 661 3 15
ENSDART00000130626 Nonsense 115 661 3 15
ENSDART00000132743 Nonsense 113 273 3 7
ENSDART00000136211 Nonsense 110 229 2 5
ENSDART00000145191 Nonsense 49 128 3 5

The following transcripts of ENSDARG00000054530 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 34300470)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35300163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCACCACTCTCGGTCACCCCCAGTCAGCAGGCTAAGTTTGGCGACTAT[C/T]AGTGCAACAGTGCCATGGCCATGTCTCAGGTTAGTTTCATTTAAACCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076729 Nonsense 144 661 4 15
ENSDART00000130626 Nonsense 144 661 4 15
ENSDART00000132743 Nonsense 142 273 4 7
ENSDART00000136211 Nonsense 139 229 3 5
ENSDART00000145191 Nonsense 78 128 4 5

The following transcripts of ENSDARG00000054530 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 34300741)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35300434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCCAAAGGACTGAAAGTCAGCCCCAGAGAGATCGCAGAGAAGATCGTC[C/T]AAAACATTCCCAACAATGACTTAATTGAAAAAACTGAAATTGCTGGGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076729 Nonsense 151 661 4 15
ENSDART00000130626 Nonsense 151 661 4 15
ENSDART00000132743 Nonsense 149 273 4 7
ENSDART00000136211 Nonsense 146 229 3 5
ENSDART00000145191 Nonsense 85 128 4 5

The following transcripts of ENSDARG00000054530 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 34300763)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35300456
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCAGAGAGATCGCAGAGAAKATCGTCCAAAACATTCCCAACAATGACT[T/A]RATTGAAAAAACTGAAATTGCTGGGCCAGGTATAGTTTCAGAACACTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076729 Essential Splice Site 275 661 7 15
ENSDART00000130626 Essential Splice Site 275 661 7 15
ENSDART00000132743   273 273 7 7
ENSDART00000136211   None 229 None 5
ENSDART00000145191   None 128 None 5

The following transcripts of ENSDARG00000054530 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 34305724)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 35305417
KASP Assay ID:
554-7879.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATCTCAGTGTGTCTCCACCTATTGGTGACCTTCAGGCTTTCTACAAA[G/T]TGAGTATCTGTTAAATTCAAAACAATTGTTTAACCTAAACTTGGTGGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link