MUC17

Ensembl ID:
ENSDARG00000054528
Description:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38871 Nonsense Mutation detected in F1 DNA During 2016
sa15291 Nonsense Available for shipment Available now
sa6232 Nonsense Mutation detected in F1 DNA During 2016
sa41955 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110641 Nonsense 212 2043 3 7
Genomic Location (Zv9):
Chromosome 12 (position 6027932)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4795106
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGAATCAAGGCCCCTCAATGCTGTTAAGGATCTATTTCAAAGGCTG[C/A]TATGCTCAAAACTGGGTAAGACATTCTCCTTGCAATAGCAATTTAAATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110641 Nonsense 358 2043 6 7
Genomic Location (Zv9):
Chromosome 12 (position 6030420)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4792618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAAAAAGGGCAGTAGAAAACGAAGACAAGATGYATTTGATTTTGAYT[G/A]GGAGTTTGATTCAGTTCCGACGGATTCCTTTATACCGAAGATTGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110641 Nonsense 415 2043 6 7
Genomic Location (Zv9):
Chromosome 12 (position 6030592)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4792446
KASP Assay ID:
554-4690.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACTACTGAATTACTTGACTTTCCTCCTGATACAGTAGAAACTGATTA[T/G]CTAGATTTTGATTATTTCGATTTGAGGAAAGACCATGTCAACCCCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110641 Nonsense 627 2043 6 7
Genomic Location (Zv9):
Chromosome 12 (position 6031228)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 4791810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCCTTCAAGTCCAGACTATACTATACAAACAAACACTGTTACCTTCTG[G/A]CCCCCCGATGTACTTGGTACCACCAAAACATCAAGTGATGTTGCAAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link