MUC17

Ensembl ID:
ENSDARG00000054528
Description:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15291 Nonsense Available for shipment Available now
sa6232 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110641 Nonsense 358 2043 6 7
Genomic Location:
Chromosome 12 (position 6030420)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAAAAAGGGCAGTAGAAAACGAAGACAAGATGYATTTGATTTTGAYT[G/A]GGAGTTTGATTCAGTTCCGACGGATTCCTTTATACCGAAGATTGCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6232
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110641 Nonsense 415 2043 6 7
Genomic Location:
Chromosome 12 (position 6030592)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCACTACTGAATTACTTGACTTTCCTCCTGATACAGTAGAAACTGATTA[T/G]CTAGATTTTGATTATTTCGATTTGAGGAAAGACCATGTCAACCCCTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/390o0hxo