LOC798445

Ensembl ID:
ENSDARG00000054515
Human Orthologues:
CASP3, CASP6, CASP7
Human Descriptions:
caspase 3, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1504]
caspase 6, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1507]
caspase 7, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1508]
Mouse Orthologues:
Casp3, Casp6, Casp7
Mouse Descriptions:
caspase 3 Gene [Source:MGI Symbol;Acc:MGI:107739]
caspase 6 Gene [Source:MGI Symbol;Acc:MGI:1312921]
caspase 7 Gene [Source:MGI Symbol;Acc:MGI:109383]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41733 Nonsense Mutation detected in F1 DNA During 2017
sa30654 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41733
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076712 Nonsense 15 232 1 4
Genomic Location (Zv9):
Chromosome 10 (position 43522750)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42329245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAACAGGGCGCTGATCGTCTCTGTGGAAAACTTTTATCCTGGGGCCTA[T/A]TTGTGCAGGAGAATCGGTGTGAAGAGAGACAGTCGAAGGCTTTACAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30654
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076712 Nonsense 19 232 1 4
Genomic Location (Zv9):
Chromosome 10 (position 43522760)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 42329255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGATCGTCTCTGTGGAAAACTTTTATCCTGGGGCCTATTTGTGCAGG[A/T]GAATCGGTGTGAAGAGAGACAGTCGAAGGCTTTACAAGATCCTCAGCGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link