adrb2b

Ensembl ID:
ENSDARG00000054510
ZFIN ID:
ZDB-GENE-070410-32
Description:
adrenergic, beta-2-, receptor, surface [Source:RefSeq peptide;Acc:NP_001082940]
Human Orthologue:
ADRB2
Human Description:
adrenergic, beta-2-, receptor, surface [Source:HGNC Symbol;Acc:286]
Mouse Orthologue:
Adrb2
Mouse Description:
adrenergic receptor, beta 2 Gene [Source:MGI Symbol;Acc:MGI:87938]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6680 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076713 Nonsense 106 409 1 1
ENSDART00000146454 Nonsense 106 409 2 2
Genomic Location:
Chromosome 21 (position 34047828)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTCTTATGGTGGTGCCCTTCGGCGCATGCTACATTCTCCTCAATRCAT[G/A]GCACTTTGGAAACTTCTTTTKCGAGTTTTGGACGGCTACGGATGTATTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rbhnnd7a