hesx1

Ensembl ID:
ENSDARG00000054509
ZFIN ID:
ZDB-GENE-990415-130
Description:
hesx homeobox 1 [Source:RefSeq peptide;Acc:NP_571424]
Human Orthologue:
HESX1
Human Description:
HESX homeobox 1 [Source:HGNC Symbol;Acc:4877]
Mouse Orthologue:
Hesx1
Mouse Description:
homeobox gene expressed in ES cells Gene [Source:MGI Symbol;Acc:MGI:96071]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14173 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14173
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076711 Nonsense 69 72 2 2
Genomic Location:
Chromosome 11 (position 43715021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTCCCAGTTCCTCATGGTGAAAAACGTCCTCAGCGATTTACAAACCGGC[A/T]GAGAAGAACACTGAGAGTAGAACTACATTTCTNNNNNNNNNNNNNNNTTM
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9tsxoedg