LOC568467

Ensembl ID:
ENSDARG00000054497
Human Orthologue:
CHRNA3
Human Description:
cholinergic receptor, nicotinic, alpha 3 [Source:HGNC Symbol;Acc:1957]
Mouse Orthologue:
Chrna3
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 3 Gene [Source:MGI Symbol;Acc:MGI:87887]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6539 Nonsense Mutation detected in F1 DNA During 2014
sa14384 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6539
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002296 Nonsense 70 483 3 5
Genomic Location:
Chromosome 18 (position 49577948)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTGAANTTTTTTACAGATTTGGAATGACTATAAGCTCMGATGGGATCCC[A/T]AGGATTTTGGAGGTGTTGAGTTCATCCGTGTGCCRTCCAACAAGATTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14384
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002296 Nonsense 105 483 4 5
Genomic Location:
Chromosome 18 (position 49578955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTTATTTGCGCATCACAGTGCGGTGGGAGATTTCCAGGTGGACGAT[A/T]AAACCAAAGCCCTTCTGCGCTTCAATGGAGACGTGACCTGGATCCCACCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/owqqr19v