tinf2

Ensembl ID:
ENSDARG00000054473
ZFIN ID:
ZDB-GENE-030131-6168
Description:
TERF1 (TRF1)-interacting nuclear factor 2 [Source:RefSeq peptide;Acc:NP_001073496]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20920 Nonsense Mutation detected in F1 DNA During 2014
sa20921 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20920
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101392 Nonsense 116 549 5 10
ENSDART00000137481 None None 130 None 4
ENSDART00000141165 Nonsense 152 585 5 10
Genomic Location:
Chromosome 7 (position 25197453)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTAACTGCCTAAATGCTAACATTGTTTTGTCTCACTCCAGGAGGATTTT[C/T]AACTTCACTATGGAAGAAACTATGCTGCCAGTCTAGAGAAGTTAATGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101392 Nonsense 420 549 7 10
ENSDART00000137481 Nonsense 84 130 1 4
ENSDART00000141165 Nonsense 456 585 7 10
Genomic Location:
Chromosome 7 (position 25201241)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAACATCAGCAGTAATGCTCTTCCTGTCCAGCTGAATCATCTGGCTGAA[G/T]AGAAGGACGGTACGAGTTATTCAGGCCAGTCTAACTCAAAAGACAGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eg8pomj4