Q3B740_DANRE

Ensembl ID:
ENSDARG00000054456
Description:
LOC562450 protein [Source:UniProtKB/TrEMBL;Acc:Q3B740]
Human Orthologue:
CLIP3
Human Description:
CAP-GLY domain containing linker protein 3 [Source:HGNC Symbol;Acc:24314]
Mouse Orthologue:
Clip3
Mouse Description:
CAP-GLY domain containing linker protein 3 Gene [Source:MGI Symbol;Acc:MGI:1923936]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22666 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076648   None 385 None 9
ENSDART00000124922 Nonsense 464 539 10 13
Genomic Location (Zv9):
Chromosome 15 (position 28351215)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 29069245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGATGGCAGTGTGTTTGGAGTACGCTACTTCCACTGTTTGCCCAAATA[T/A]GGAGTTTTTGCACCACCATCCCGTGTTCAGAGGTAAAACCTTCAACATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link