epha4a

Ensembl ID:
ENSDARG00000054454
ZFIN ID:
ZDB-GENE-001207-7
Description:
Ephrin type-A receptor 4a [Source:UniProtKB/Swiss-Prot;Acc:O13148]
Human Orthologue:
EPHA4
Human Description:
EPH receptor A4 [Source:HGNC Symbol;Acc:3388]
Mouse Orthologue:
Epha4
Mouse Description:
Eph receptor A4 Gene [Source:MGI Symbol;Acc:MGI:98277]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa208 Nonsense Confirmed mutation in F2 line During 2014
sa9644 Nonsense Available for shipment Available now
sa9998 Essential Splice Site Available for shipment Available now
sa17262 Nonsense Available for shipment Available now
sa15903 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa208
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098632 Nonsense 260 986 3 18
Genomic Location:
Chromosome 2 (position 39836017)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGTACTGCGGAGCAGATGGAGAATGGCTGGTGCCTATTGGAAACTG[T/A]TTGTGTAACCCTGGCTATGAAGAACATGAAGGGACATGTCAAGGTAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9644
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098632 Nonsense 292 986 4 18
Genomic Location:
Chromosome 2 (position 39804440)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAAGATCGGYAACTACAGAGCTCTAGCCACAGACGGCAGCTGCTCT[A/T]AGTGTCCCCTGCACAGCTACTCTGTGAGAGAGGGATCTACTTCCTGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9998
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098632 Essential Splice Site 327 986 5 18
Genomic Location:
Chromosome 2 (position 39798689)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTTAGTTTCTCTGACAGWGTGCATTTTTTNNCCAAAATTGTCTTTTCGY[A/T]GAGCCCCCATCTGCTCCTCAGCACCTCATTTCCAATGTGAACGAGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17262
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098632 Nonsense 478 986 6 18
Genomic Location:
Chromosome 2 (position 39794638)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CARCCCGAGAGACCCAATGGAGTCATTCTTGAGTACGAGGTCAAATACTA[T/G]GAGAAGGTGAGATGATTCRTGGGAAAGAAGTGTGCAAAACTTCTGCKTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15903
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098632 Essential Splice Site 534 986 7 18
Genomic Location:
Chromosome 2 (position 39793412)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGGCTACGGAGAATTCAGTGCCCCTTTTGAGTTCATGACCAACTCAGG[T/C]AGGTTTCCTTGTGCGTGTTACAGAACCAACAATGGCARGKCTTTGTTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Brain imaging: Whole genome association study of brain-wide imaging phenotypes for identifying quantitative trait loci in MCI and AD: A study of the ADNI cohort. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/60kyt9jr