loxl1

Ensembl ID:
ENSDARG00000054451
ZFIN ID:
ZDB-GENE-060503-693
Description:
lysyl oxidase homolog 1 [Source:RefSeq peptide;Acc:NP_001036790]
Human Orthologue:
LOXL1
Human Description:
lysyl oxidase-like 1 [Source:HGNC Symbol;Acc:6665]
Mouse Orthologue:
Loxl1
Mouse Description:
lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23390 Nonsense Mutation detected in F1 DNA During 2014
sa16620 Nonsense Available for shipment Available now
sa5916 Essential Splice Site Mutation detected in F1 DNA During 2014
sa6538 Nonsense Mutation detected in F1 DNA During 2014
sa1005 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23390
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 26 527 1 7
ENSDART00000127496 Nonsense 22 526 1 8
Genomic Location:
Chromosome 18 (position 49006133)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGATGAGCTTGTGGGTATTAGGAAGTGTAACGGGACAGTCCCAATCT[C/T]AACCCGACGACACAAACCCATGGAGGCAGATGATCCAGTGGGAGAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 128 527 1 7
ENSDART00000127496 Nonsense 124 526 1 8
Genomic Location:
Chromosome 18 (position 49005827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAAAACTGGCGGCAGCAGCAAGGTGCGGTKGGAAGAAGCGAAACAAGT[C/T]GATTTCAGTCACAAACCGGCTCTCGTTATAGACCGTCATCNNNNNNNNNA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Essential Splice Site 169 527 None 7
ENSDART00000127496 None 166 526 2 8
Genomic Location:
Chromosome 18 (position 49004300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTNNCAACAATTGTCACTAAAATAACCTTGTTTATGAYCCAGTTTC[A/T]GACAGGTCATATGAACCTCCATTCCKTGGGACGGGGTRTTCGGCAGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 171 527 2 7
ENSDART00000127496 Nonsense 169 526 2 8
Genomic Location:
Chromosome 18 (position 49004292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAATTGTCACTAAAATAACCTTGTTTATGAYCCAGTTTCWGACAGGT[C/A]ATATGAACCTCCATTCCKTGGGACGGGGTRTTCGGCAGGCACGGGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 216 527 2 7
ENSDART00000127496 Nonsense 214 526 2 8
Genomic Location:
Chromosome 18 (position 49004156)
KASP Assay ID:
554-0909.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGTTTCGGTGGAGGAAATCCTGCAAATGATGATCGATATCGATWTTA[T/A]CCACCGTWCGGTCAACAATACCAGGCTGTTCCMGCCCAACCTGCACAGCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ypa5xwzt