loxl1

Ensembl ID:
ENSDARG00000054451
ZFIN ID:
ZDB-GENE-060503-693
Description:
lysyl oxidase homolog 1 [Source:RefSeq peptide;Acc:NP_001036790]
Human Orthologue:
LOXL1
Human Description:
lysyl oxidase-like 1 [Source:HGNC Symbol;Acc:6665]
Mouse Orthologue:
Loxl1
Mouse Description:
lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23390 Nonsense Available for shipment Available now
sa16620 Nonsense Available for shipment Available now
sa5916 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6538 Nonsense Mutation detected in F1 DNA During 2016
sa1005 Nonsense Available for shipment Available now
sa36736 Nonsense Mutation detected in F1 DNA During 2016
sa36735 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 26 527 1 7
ENSDART00000127496 Nonsense 22 526 1 8
Genomic Location (Zv9):
Chromosome 18 (position 49006133)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50155339
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGATGAGCTTGTGGGTATTAGGAAGTGTAACGGGACAGTCCCAATCT[C/T]AACCCGACGACACAAACCCATGGAGGCAGATGATCCAGTGGGAGAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 128 527 1 7
ENSDART00000127496 Nonsense 124 526 1 8
Genomic Location (Zv9):
Chromosome 18 (position 49005827)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50155033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGAAAACTGGCGGCAGCAGCAAGGTGCGGTKGGAAGAAGCGAAACAAGT[C/T]GATTTCAGTCACAAACCGGCTCTCGTTATAGACCGTCATCNNNNNNNNNA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5916
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Essential Splice Site 169 527 None 7
ENSDART00000127496   166 526 2 8
Genomic Location (Zv9):
Chromosome 18 (position 49004300)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50153506
KASP Assay ID:
554-3805.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTTTNNCAACAATTGTCACTAAAATAACCTTGTTTATGAYCCAGTTTC[A/T]GACAGGTCATATGAACCTCCATTCCKTGGGACGGGGTRTTCGGCAGGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6538
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 171 527 2 7
ENSDART00000127496 Nonsense 169 526 2 8
Genomic Location (Zv9):
Chromosome 18 (position 49004292)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50153498
KASP Assay ID:
554-5151.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACAATTGTCACTAAAATAACCTTGTTTATGAYCCAGTTTCWGACAGGT[C/A]ATATGAACCTCCATTCCKTGGGACGGGGTRTTCGGCAGGCACGGGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 216 527 2 7
ENSDART00000127496 Nonsense 214 526 2 8
Genomic Location (Zv9):
Chromosome 18 (position 49004156)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50153362
KASP Assay ID:
554-0909.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCAGTTTCGGTGGAGGAAATCCTGCAAATGATGATCGATATCGATWTTA[T/A]CCACCGTWCGGTCAACAATACCAGGCTGTTCCMGCCCAACCTGCACAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Nonsense 316 527 2 7
ENSDART00000127496 Nonsense 314 526 2 8
Genomic Location (Zv9):
Chromosome 18 (position 49003856)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50153062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCTCCAACACTGCAGAAAACCCCAACATCAATGTAGGCAGCGTTTA[T/A]CGCCCTCAACAAAGAGGTAGGATGCTTCTGAAATACACTGAAAAAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006078 Essential Splice Site 456 527 5 7
ENSDART00000127496 Essential Splice Site 454 526 5 8
Genomic Location (Zv9):
Chromosome 18 (position 48986351)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 50135557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCGACTTCGGCCATCTGAAGAGATACGCCTGCACTGCACACACACAG[G/A]TCAATATCATCTGCTGCTACTCGCAATGACGTTATTTATAGCAGGGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link