si:ch1073-98b4.1

Ensembl ID:
ENSDARG00000054448
ZFIN ID:
ZDB-GENE-090312-119
Human Orthologue:
KIF1C
Human Description:
kinesin family member 1C [Source:HGNC Symbol;Acc:6317]
Mouse Orthologues:
Gm1305, Kif1c
Mouse Descriptions:
kinesin family member 1C Gene [Source:MGI Symbol;Acc:MGI:1098260]
predicted gene 1305 Gene [Source:MGI Symbol;Acc:MGI:2686151]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8622 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37798 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17181 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076647 Essential Splice Site 36 240 None 7
ENSDART00000143054 Essential Splice Site 35 239 None 6
Genomic Location (Zv9):
Chromosome 23 (position 44793242)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44860691
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACAACCATGATGCKAAATGTGTCATCCAGATGCAGGGAAACACCACCTG[T/A]GAGTGCACACACCRCATATGACAGTACATAATKTTTGACTGGATRTWCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37798
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076647 Essential Splice Site 136 240 5 7
ENSDART00000143054   None 239 None 6
Genomic Location (Zv9):
Chromosome 23 (position 44786792)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44854241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTAGCTCAGACCGGGCTGGGTGCAGTAGGATCGATGGGTTATATATA[G/T]ATATCAGTCATTTTCTTTTCGGCTTGCAAACTCCACACAGAAAACTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17181
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076647 Essential Splice Site 143 240 5 7
ENSDART00000143054   None 239 None 6
Genomic Location (Zv9):
Chromosome 23 (position 44786769)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 44854218
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGTAGGATCGATGGGTTATATATANNGATATCAKTCATTTTCTWTTCGG[C/T]TTGCAAACTCCACACAGAAMACTGACCCAGYCGAGGCTYGAACCTGCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link