ccdc43

Ensembl ID:
ENSDARG00000054446
ZFIN ID:
ZDB-GENE-040426-1587
Description:
Coiled-coil domain-containing protein 43 [Source:UniProtKB/Swiss-Prot;Acc:Q6PFL6]
Human Orthologue:
CCDC43
Human Description:
coiled-coil domain containing 43 [Source:HGNC Symbol;Acc:26472]
Mouse Orthologue:
Ccdc43
Mouse Description:
coiled-coil domain containing 43 Gene [Source:MGI Symbol;Acc:MGI:1289318]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33206 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076640   None 213 None 5
ENSDART00000126802   None 246 None 5
ENSDART00000145148 Essential Splice Site 86 92 3 5
ENSDART00000148189   None 163 None 4
Genomic Location (Zv9):
Chromosome 3 (position 31739362)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31470672
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAATGTTATGCGGGAAGCGTCCAGTTTTTCCAAAAAAAAAAAAAAAT[A/C]GTGCTTTGCTTTGTTTTGTTTTAAGCTGAAGTTCAGGCCATTGCTAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link