si:ch211-198n5.12

Ensembl ID:
ENSDARG00000054420
ZFIN ID:
ZDB-GENE-081104-505
Description:
retinal pigment epithelium-specific protein 65kDa [Source:RefSeq peptide;Acc:NP_001107125]
Human Orthologue:
RPE65
Human Description:
retinal pigment epithelium-specific protein 65kDa [Source:HGNC Symbol;Acc:10294]
Mouse Orthologue:
Rpe65
Mouse Description:
retinal pigment epithelium 65 Gene [Source:MGI Symbol;Acc:MGI:98001]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11158 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038725 Essential Splice Site 82 532 3 14
ENSDART00000076600 Essential Splice Site 82 532 3 14
Genomic Location (Zv9):
Chromosome 8 (position 17231102)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16675990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCMTTCACAAATTTGACCTGAAGGATGGACGTGTTACATATCATCGCAGG[T/C]AAAATGACTAATAATTTATGAAATGATCAACACTGGGGCACTGCTCATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link