NP_001135736.1

Ensembl ID:
ENSDARG00000054414
Description:
spermatogenesis-associated protein 17 [Source:RefSeq peptide;Acc:NP_001135736]
Human Orthologue:
SPATA17
Human Description:
spermatogenesis associated 17 [Source:HGNC Symbol;Acc:25184]
Mouse Orthologue:
Spata17
Mouse Description:
spermatogenesis associated 17 Gene [Source:MGI Symbol;Acc:MGI:1921967]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23109 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076596 Nonsense 47 357 2 10
Genomic Location (Zv9):
Chromosome 17 (position 30264861)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 30188788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAGAGAATGAGGCAGCGGTCAGGATTCAGAGCTGGTTCAGGGGCTG[T/A]CAGGTGAGAGCGTACATCAGGTAAGACAAAACTTTTGAGATCTCTTTTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link