si:ch211-198n5.11

Ensembl ID:
ENSDARG00000054400
ZFIN ID:
ZDB-GENE-050411-52
Description:
methylcrotonoyl-Coenzyme A carboxylase 2 [Source:RefSeq peptide;Acc:NP_001107124]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2419 Essential Splice Site F2 line generated During 2017
sa14584 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2419
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076586 Essential Splice Site 7 603 1 13
ENSDART00000136478 Essential Splice Site 7 50 1 6

The following transcripts of ENSDARG00000054400 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 17196394)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16641282
KASP Assay ID:
554-2572.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTTAGAGCTGTGCCTGTTGTCTCATCATGCACTGTTGTTTATTACGG[T/C]AAGGTCTTCTGCTTTATGTTATAGTAAGCTAATGTGGTAACGCGGTTTTG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa14584
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076586 Nonsense 334 603 7 13
ENSDART00000136478   None 50 None 6

The following transcripts of ENSDARG00000054400 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 17203186)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16648074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGTRAGTGGCTGTGTAGACCATTTTGCGGCAGYAGARTCAGAGGCGTA[T/G]GAATACACCAGAAACATCATCTCCACCCTCAACTATGAGCTCCCAGAAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link