otul

Ensembl ID:
ENSDARG00000054374
ZFIN ID:
ZDB-GENE-060307-1
Description:
OTU like protein [Source:RefSeq peptide;Acc:NP_001027008]
Human Orthologue:
ALG13
Human Description:
asparagine-linked glycosylation 13 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:30881]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23993 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000064320 Nonsense 397 859 14 25
ENSDART00000124649 Nonsense 427 889 13 24
Genomic Location:
Chromosome 21 (position 33213378)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTGCACAGTCCAGCTCCTCCTCCTCCCGGTCTGATTTATGAACACTAC[C/T]GACCCCACCCTCCACCTAGACAGCCGCGTGGGTATGGACCACCCAGGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4q6xn0g6