si:ch211-126g16.10

Ensembl ID:
ENSDARG00000054373
ZFIN ID:
ZDB-GENE-081104-528
Description:
hypothetical protein LOC100002020 [Source:RefSeq peptide;Acc:NP_001122024]
Human Orthologues:
B3GNT3, B3GNT6
Human Descriptions:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 [Source:HGNC Symbol;Acc:13528]
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) [Source:HGNC Symbol;
Mouse Orthologues:
B3gnt3, B3gnt6
Mouse Descriptions:
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:215253
UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (core 3 synthase) Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27149 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076561 Nonsense 204 387 2 2
ENSDART00000080872 Nonsense 204 387 1 2
Genomic Location (Zv9):
Chromosome 8 (position 14090036)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 13535380
KASP Assay ID:
2260-0275.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTCTTCAACCTCACACTGAAGCAGATCCTTTTCTTAGAGTGGATGGAC[A/T]GAAGGTGCCCGAACGCCAGATTCCTTTTAAATGGAGACGATGACATTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Tumor biomarkers: A genome wide association study of genetic loci that influence tumour biomarkers cancer antigen 19-9, carcinoembryonic antigen and α fetoprotein and their associations with cancer risk. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link