dcaf7

Ensembl ID:
ENSDARG00000054355
ZFIN ID:
ZDB-GENE-030131-9511
Description:
DDB1- and CUL4-associated factor 7 [Source:RefSeq peptide;Acc:NP_956363]
Human Orthologue:
DCAF7
Human Description:
DDB1 and CUL4 associated factor 7 [Source:HGNC Symbol;Acc:30915]
Mouse Orthologue:
Dcaf7
Mouse Description:
DDB1 and CUL4 associated factor 7 Gene [Source:MGI Symbol;Acc:MGI:1919083]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14350 Nonsense Available for shipment Available now
sa33209 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058221 Nonsense 145 342 4 7

The following transcripts of ENSDARG00000054355 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 31858809)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31590119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGTTTATTTTCTGTTTTTCAGGGACATCTAGTATTGACACCACTTG[T/A]ACAATCTGGGGTCTAGAGACAGGACAGGTCCTGGGAAGAGTCAACCTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058221 Essential Splice Site 246 342 5 7

The following transcripts of ENSDARG00000054355 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 31859228)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 31590538
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAACAGGACCCTAACTACTTGGCCACCATGGCAATGGATGGCATGGAG[G/A]TTTGTTTTTCTTTTTCTTCAGCAAGATGTCTGTAGTCTTCTTGTTGTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link