lrrc9

Ensembl ID:
ENSDARG00000054352
ZFIN ID:
ZDB-GENE-080917-56
Description:
leucine-rich repeat-containing protein 9 [Source:RefSeq peptide;Acc:NP_001107274]
Mouse Orthologue:
Lrrc9
Mouse Description:
leucine rich repeat containing 9 Gene [Source:MGI Symbol;Acc:MGI:1925507]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9718 Nonsense Available for shipment Available now
sa22336 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa1345 Essential Splice Site, Missense Available for shipment Available now
sa6312 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076533 Nonsense 478 984 11 21
ENSDART00000100719 Nonsense 514 1350 13 30
ENSDART00000114995 Nonsense 478 985 12 22
ENSDART00000141217 None None 258 None 7
ENSDART00000146752 None None 447 None 11
ENSDART00000148112 Nonsense 257 626 6 13
Genomic Location:
Chromosome 13 (position 31709467)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTYTYTCTAACAGCATGAGTGTGTCTGATCGACTGAGAATGACTTTCATG[C/T]AAAGGATGARCTGCTCAACATCAAACCGAGAGCTTCTACCCTTCAGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076533 Nonsense 535 984 12 21
ENSDART00000100719 Splice Site None 1350 None 30
ENSDART00000114995 Nonsense 535 985 13 22
ENSDART00000141217 None None 258 None 7
ENSDART00000146752 None None 447 None 11
ENSDART00000148112 Nonsense 314 626 7 13
Genomic Location:
Chromosome 13 (position 31711555)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGATCATTATCCCAAGGCAAACTCAGTCTACCTCAGTACCAGCTCTAAA[C/T]AACAAAGTCACACAGCTCAAACAACCCCTGGTGAGTTTAAGCACGTGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1345
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076533 Essential Splice Site 586 984 13 21
ENSDART00000100719 Missense 616 1350 15 30
ENSDART00000114995 Essential Splice Site 587 985 14 22
ENSDART00000141217 None None 258 None 7
ENSDART00000146752 None None 447 None 11
ENSDART00000148112 Essential Splice Site 365 626 8 13
Genomic Location:
Chromosome 13 (position 31711812)
KASP Assay ID:
554-1259.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAAATGGTACTTCCAGAATACCTTGTGGACTTTGAATATGTAACCCAGG[T/C]ATTGGTATATGTTAKTATATTTACACTTATACATCCACACTAGAATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6312
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076533 None None 984 None 21
ENSDART00000100719 Essential Splice Site 1174 1350 26 30
ENSDART00000114995 None None 985 None 22
ENSDART00000141217 None None 258 None 7
ENSDART00000146752 Essential Splice Site 153 447 4 11
ENSDART00000148112 None None 626 None 13
Genomic Location:
Chromosome 13 (position 31725836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAAAGTTAGTTCCAGTGGATACGGGCAGCAGAACAGCAGACCCAGCAGG[T/C]ACACACATACACACATGTAYGCACGYACACTCCTGAATAAGKKATTTATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pxrknitq