B0R025_DANRE

Ensembl ID:
ENSDARG00000054343
Description:
Novel protein similar to human solute carrier family 7 (Cationic amino acid transporter, y+ system),
Human Orthologue:
SLC7A8
Human Description:
solute carrier family 7 (amino acid transporter, L-type), member 8 [Source:HGNC Symbol;Acc:11066]
Mouse Orthologue:
Slc7a8
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene [Source:MGI Symb

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39895 Nonsense Mutation detected in F1 DNA During 2016
sa10837 Essential Splice Site Available for shipment Available now
sa5160 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076523 Nonsense 97 501 2 11
Genomic Location:
Chromosome 2 (position 38034735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTGCTATGCTGAACTAGGAGTCACAATCCCAAAGTCAGGTGGAGATTA[T/A]TCCTACGTTAATGACATCTTTGGAGGGCTTGCTGGGTAAGACTGACTCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076523 Essential Splice Site 471 501 10 11
Genomic Location:
Chromosome 2 (position 38020986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCATCTATTGGGAAAATAAGCCCAAGAGCTTCAGTTCTTTTGTTGG[T/A]ATGAAGAAATCTTAAATCTTATGTGATAATGTTAAARAKGATTTACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076523 Nonsense 478 501 11 11
Genomic Location:
Chromosome 2 (position 38020832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCCAYCTGCCATTGTATGTACACACAGCCAGACTGACACACTTGGGG[C/T]AGAAGTTGTGCCTGGTGGTTTACCCTGGCGAGGACAGAGAAGATGGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link