B0R025_DANRE

Ensembl ID:
ENSDARG00000054343
Description:
Novel protein similar to human solute carrier family 7 (Cationic amino acid transporter, y+ system),
Human Orthologue:
SLC7A8
Human Description:
solute carrier family 7 (amino acid transporter, L-type), member 8 [Source:HGNC Symbol;Acc:11066]
Mouse Orthologue:
Slc7a8
Mouse Description:
solute carrier family 7 (cationic amino acid transporter, y+ system), member 8 Gene [Source:MGI Symb

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10837 Essential Splice Site Available for shipment Available now
sa5160 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10837
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076523 Essential Splice Site 471 501 10 11
Genomic Location:
Chromosome 2 (position 38020986)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGCATCTATTGGGAAAATAAGCCCAAGAGCTTCAGTTCTTTTGTTGG[T/A]ATGAAGAAATCTTAAATCTTATGTGATAATGTTAAARAKGATTTACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076523 Nonsense 478 501 11 11
Genomic Location:
Chromosome 2 (position 38020832)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCCAYCTGCCATTGTATGTACACACAGCCAGACTGACACACTTGGGG[C/T]AGAAGTTGTGCCTGGTGGTTTACCCTGGCGAGGACAGAGAAGATGGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gmi2fna5