si:ch211-208c6.2

Ensembl ID:
ENSDARG00000054332
ZFIN ID:
ZDB-GENE-040724-145
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHY6]
Human Orthologue:
TRIM66
Human Description:
tripartite motif-containing 66 [Source:HGNC Symbol;Acc:29005]
Mouse Orthologue:
Trim66
Mouse Description:
tripartite motif-containing 66 Gene [Source:MGI Symbol;Acc:MGI:2152406]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31574 Essential Splice Site Available for shipment Available now
sa13594 Essential Splice Site Available for shipment Available now
sa18194 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076510 Essential Splice Site 534 1119 12 26
ENSDART00000132316   None 53 None 3
ENSDART00000132784   None 195 None 5
ENSDART00000137799   None 416 None 6
Genomic Location (Zv9):
Chromosome 7 (position 29772817)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28165340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCGCTGGTTCAGGGCCAGGGAGGCGATGGTCGGAGTTGTCCAGGTTTGA[A/T]GAGGGCGAGCAGGTCTCAAAGCAGTGCGGATGCACCCAGAGGACCTCGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13594
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076510 Essential Splice Site 588 1119 14 26
ENSDART00000132316   None 53 None 3
ENSDART00000132784   None 195 None 5
ENSDART00000137799   None 416 None 6
Genomic Location (Zv9):
Chromosome 7 (position 29772564)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28165087
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAYGATATCATGTTTCTTCAAGGAGTGATTTTAGATCAGAGTTCTTYAA[A/G]TAACTTGAACAATGTTTTTTTTTTTTCTTCAGTGTTAAGAAGCTTTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18194
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076510 Nonsense 761 1119 21 26
ENSDART00000132316   None 53 None 3
ENSDART00000132784   None 195 None 5
ENSDART00000137799 Nonsense 52 416 2 6
Genomic Location (Zv9):
Chromosome 7 (position 29766932)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28159455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCATAGCTGTGAATCATCTGGCTCCCTTGAGGAMTCTCAGCCTCCTGTG[C/T]AAGAATTTTGCAATATAAACCAAGAGTCTGATGCRCTATCTGTTTCCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link