AP2A1

Ensembl ID:
ENSDARG00000054320
Description:
adaptor-related protein complex 2, alpha 1 subunit [Source:HGNC Symbol;Acc:561]
Human Orthologue:
AP2A1
Human Description:
adaptor-related protein complex 2, alpha 1 subunit [Source:HGNC Symbol;Acc:561]
Mouse Orthologue:
Ap2a1
Mouse Description:
adaptor protein complex AP-2, alpha 1 subunit Gene [Source:MGI Symbol;Acc:MGI:101921]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20049 Nonsense Mutation detected in F1 DNA During 2014
sa20050 Nonsense Mutation detected in F1 DNA During 2014
sa20051 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa713 Splice Site, Nonsense F2 line generated During 2014
sa1907 Essential Splice Site Available for shipment Available now
sa9933 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076469 Nonsense 222 938 5 22
Genomic Location:
Chromosome 3 (position 32521024)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTTTTCTTTTAGGGTGTAGTCACCGCTGCCATCTCTTTGATCACCTG[T/A]CTCAGCCAGAAGAATCCTGATGAGTTCAAGACCTGTGTGTCACTTGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20050
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076469 Nonsense 554 938 11 22
Genomic Location:
Chromosome 3 (position 32526535)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTTCACCTGTGCTCAGTTCCCACCCGTGCCCTGCTGCTGTCAGCCTA[T/G]ATTAAGTTCATTAATTTGTTCCCGGAGACAAAGAGCACCATTCAGGAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076469 Splice Site, Nonsense 639 938 13 22
Genomic Location:
Chromosome 3 (position 32527010)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAATGCTGTGAGACACGAACTCTCTTAATTCAAAACTATTTAATACAGTT[G/T]AAAAGTTGGGTTAGCGTTTTTATTTTTACATAATTTATAAGTTCAACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa713
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076469 Splice Site, Nonsense 641 938 13 22
Genomic Location:
Chromosome 3 (position 32527017)
KASP Assay ID:
554-0621.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAGACACGAACTCTCTTAATTCAAAACTATTTAATACAGTTGAAAAGT[T/A]GGGTTAGCGTTTTTATTTTTACATAATTTATWAGTTCAACATTAAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076469 Essential Splice Site 707 938 15 22
Genomic Location:
Chromosome 3 (position 32528651)
KASP Assay ID:
554-1897.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTGATGTGTTCTCGGAGGCTGGTGTCAATGATGATGGCTTCCTGAGG[T/C]AAATAAGCATCTGGCTCATTACGATCCAGTCTTYTGTGCATTATTTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9933
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076469 Nonsense 778 938 18 22
Genomic Location:
Chromosome 3 (position 32533526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGAGYCCACAGCTCAATGTTCAGGCTAAACMAGTGGAACCGCTCATC[G/T]AAGGGGGTGCTCAGGTGCAACAGGTCATCAACATTGAGTGTCTGGGTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/24sj3jxg