dhrs1

Ensembl ID:
ENSDARG00000054300
ZFIN ID:
ZDB-GENE-030616-591
Description:
dehydrogenase/reductase SDR family member 1 [Source:RefSeq peptide;Acc:NP_001002205]
Human Orthologue:
DHRS1
Human Description:
dehydrogenase/reductase (SDR family) member 1 [Source:HGNC Symbol;Acc:16445]
Mouse Orthologue:
Dhrs1
Mouse Description:
dehydrogenase/reductase (SDR family) member 1 Gene [Source:MGI Symbol;Acc:MGI:1196314]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12544 Nonsense Available for shipment Available now
sa18735 Nonsense Mutation detected in F1 DNA During 2017
sa32983 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076478 Nonsense 235 310 7 9
ENSDART00000076478 Nonsense 235 310 7 9
Genomic Location (Zv9):
Chromosome 2 (position 37971676)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38286590
KASP Assay ID:
2259-2407.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTTTCACTAATGGTGAGACGACGGAGCTTAGTGGACGATGCATAGTT[G/T]AGCTAGCRAAAGGTTAGATATTATTGWTATTATTSTAATTTTATTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076478 Nonsense 235 310 7 9
ENSDART00000076478 Nonsense 235 310 7 9
Genomic Location (Zv9):
Chromosome 2 (position 37971676)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38286590
KASP Assay ID:
2259-2407.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTTTTCACTAATGGTGAGACGACGGAGCTTAGTGGACGATGCATAGTT[G/T]AGCTAGCGAAAGGTTAGATATTATTGTTATTATTGTAATTTTATTATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076478 Essential Splice Site 238 310 7 9
Genomic Location (Zv9):
Chromosome 2 (position 37971689)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38286603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTGAGACGACGGAGCTTAGTGGACGATGCATAGTTGAGCTAGCGAAAG[G/A]TTAGATATTATTGTTATTATTGTAATTTTATTATTGATTTAATGAGAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link