acin1a

Ensembl ID:
ENSDARG00000054290
ZFIN ID:
ZDB-GENE-030616-583
Description:
apoptotic chromatin condensation inducer 1a [Source:RefSeq peptide;Acc:NP_001007106]
Human Orthologue:
ACIN1
Human Description:
apoptotic chromatin condensation inducer 1 [Source:HGNC Symbol;Acc:17066]
Mouse Orthologue:
Acin1
Mouse Description:
apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19828 Essential Splice Site, Missense Mutation detected in F1 DNA During 2014
sa12080 Nonsense Available for shipment Available now
sa5158 Nonsense Mutation detected in F1 DNA During 2014
sa16806 Nonsense Available for shipment Available now
sa18032 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Missense 225 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 Essential Splice Site 224 857 5 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37919112)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCAGACCTCAACGGAGTCGTCGAGCACAGCCGCCAAAAAGTCAACCG[G/A]TGAGGACAAGATCCAGTGGCTCGCAGCAACAGCAGCAGCCACCCCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 473 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37918368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAA[C/T]GACTCGAAYGAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 476 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37918359)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAACGACTCGAA[C/T]GAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAAGAAAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 563 631 5 5
ENSDART00000076459 None None 548 None 12
ENSDART00000128043 None None 857 None 18
ENSDART00000136082 None None 572 None 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 None None 548 None 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37918097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGAT[T/A]GGAGAAAGARCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 None None 631 None 5
ENSDART00000076459 Essential Splice Site 413 548 10 12
ENSDART00000128043 Essential Splice Site 722 857 16 18
ENSDART00000136082 Essential Splice Site 437 572 10 12
ENSDART00000137395 None None 149 None 6
ENSDART00000142342 None None 260 None 6
ENSDART00000144518 Essential Splice Site 413 548 10 12
ENSDART00000146485 None None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 37902879)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCGTAAAGARAGGGGGAAGAGCAAAGAGAGGAAAGCTGATAAAAAGGG[T/G]AAGGAAAAWTTTAATGTACAYGGACTACTTTTGTGCATTGGAGTAATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uy4b6kch