acin1a

Ensembl ID:
ENSDARG00000054290
ZFIN ID:
ZDB-GENE-030616-583
Description:
apoptotic chromatin condensation inducer 1a [Source:RefSeq peptide;Acc:NP_001007106]
Human Orthologue:
ACIN1
Human Description:
apoptotic chromatin condensation inducer 1 [Source:HGNC Symbol;Acc:17066]
Mouse Orthologue:
Acin1
Mouse Description:
apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19828 Essential Splice Site, Missense Available for shipment Available now
sa32981 Nonsense Mutation detected in F1 DNA During 2016
sa12080 Nonsense Available for shipment Available now
sa32980 Nonsense Mutation detected in F1 DNA During 2016
sa16806 Nonsense Available for shipment Available now
sa39892 Essential Splice Site Mutation detected in F1 DNA During 2016
sa18032 Essential Splice Site Available for shipment Available now
sa25870 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19828
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Missense 225 631 5 5
ENSDART00000076459   None 548 None 12
ENSDART00000128043 Essential Splice Site 224 857 5 18
ENSDART00000136082   None 572 None 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518   None 548 None 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37919112)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38234026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCCAGACCTCAACGGAGTCGTCGAGCACAGCCGCCAAAAAGTCAACCG[G/A]TGAGGACAAGATCCAGTGGCTCGCAGCAACAGCAGCAGCCACCCCCCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32981
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 235 631 5 5
ENSDART00000076459   None 548 None 12
ENSDART00000128043   None 857 None 18
ENSDART00000136082   None 572 None 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518   None 548 None 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37919082)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGCCAAAAAGTCAACCGGTGAGGACAAGATCCAGTGGCTCGCAGCAA[C/T]AGCAGCAGCCACCCCCCCAACACATACCTTTACTGTCACAGCAGCTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 473 631 5 5
ENSDART00000076459   None 548 None 12
ENSDART00000128043   None 857 None 18
ENSDART00000136082   None 572 None 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518   None 548 None 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918368)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGGAGAGGGAACAAGCTTTAGAAAGAGAGAGAGCATTAGAGCAAGAA[C/T]GACTCGAAYGAGAGAGGCAAGAAAAAGAGAGGGTGGAGAAGGAAAGACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 512 631 5 5
ENSDART00000076459   None 548 None 12
ENSDART00000128043   None 857 None 18
ENSDART00000136082   None 572 None 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518   None 548 None 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918251)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGAGAGGGAGAGACTCAAGCAGGAAAGACTTGAGAAAGAAAGACAAGAA[C/T]GAGAAGAAGCTCTAGAGAGGGAGAGATTAGAAAGAGAACGGCTTGAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357 Nonsense 563 631 5 5
ENSDART00000076459   None 548 None 12
ENSDART00000128043   None 857 None 18
ENSDART00000136082   None 572 None 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518   None 548 None 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37918097)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38233011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGAGAAGGAAAGAAGAGAAAAAGAAGCTGCTCTAGAGAGGGAGAGAT[T/A]GGAGAAAGARCGTCTTGAGAAGGAAAAAAAAGAAAAAGAAGCTGCTCTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39892
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357   None 631 None 5
ENSDART00000076459 Essential Splice Site 307 548 9 12
ENSDART00000128043 Essential Splice Site 616 857 15 18
ENSDART00000136082 Essential Splice Site 331 572 9 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518 Essential Splice Site 307 548 9 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37903290)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38218204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGAGTAACCCTAAATTCCTCAGTGTTGACTTCTGTACGCAAGATGAGG[T/G]AAGCATTTCGTTTGATGGTATAGGATATTAGGTTTAAATCTTTTCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18032
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357   None 631 None 5
ENSDART00000076459 Essential Splice Site 413 548 10 12
ENSDART00000128043 Essential Splice Site 722 857 16 18
ENSDART00000136082 Essential Splice Site 437 572 10 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518 Essential Splice Site 413 548 10 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37902879)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38217793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCGTAAAGARAGGGGGAAGAGCAAAGAGAGGAAAGCTGATAAAAAGGG[T/G]AAGGAAAAWTTTAATGTACAYGGACTACTTTTGTGCATTGGAGTAATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040357   None 631 None 5
ENSDART00000076459 Nonsense 502 548 12 12
ENSDART00000128043 Nonsense 811 857 18 18
ENSDART00000136082 Nonsense 526 572 12 12
ENSDART00000137395   None 149 None 6
ENSDART00000142342   None 260 None 6
ENSDART00000144518 Nonsense 502 548 12 12
ENSDART00000146485   None 345 None 4

The following transcripts of ENSDARG00000054290 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37901381)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38216295
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCCAGCGGAACTGCTGGAGGAGAAGGTGAGAGGGGCCGAGACAGAGAA[C/T]GAGAGCGAGACAGGGGTCGAGAAAGAGAGCGCGAGGGGGACAAGCGGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link