pcdh10a

Ensembl ID:
ENSDARG00000054274
ZFIN ID:
ZDB-GENE-020731-1
Description:
protocadherin 10a [Source:RefSeq peptide;Acc:NP_997736]
Human Orthologue:
PCDH10
Human Description:
protocadherin 10 [Source:HGNC Symbol;Acc:13404]
Mouse Orthologue:
Pcdh10
Mouse Description:
protocadherin 10 Gene [Source:MGI Symbol;Acc:MGI:1338042]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32618 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076443 Nonsense 449 1000 4 7
ENSDART00000105494 Nonsense 452 999 3 6
ENSDART00000127020 Nonsense 433 868 1 3
Genomic Location (Zv9):
Chromosome 1 (position 12125557)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 12078469
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAAAACGACAACGCGCCCAGATTCATGCAGTCGGTTTACGACGTGTA[C/A]GTAACAGAGAATAACGTCCCAGGCGCTTACATTTACGCGGTGAGCGCCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link