caprin1b

Ensembl ID:
ENSDARG00000054272
ZFIN ID:
ZDB-GENE-040426-2020
Description:
cell cycle associated protein 1b [Source:RefSeq peptide;Acc:NP_998233]
Human Orthologue:
CAPRIN1
Human Description:
cell cycle associated protein 1 [Source:HGNC Symbol;Acc:6743]
Mouse Orthologue:
Caprin1
Mouse Description:
cell cycle associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:1858234]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23351 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23351
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098889 Nonsense 301 695 9 18
ENSDART00000139519 None None 87 None 3
ENSDART00000143016 None None 127 None 5

The following transcripts of ENSDARG00000054272 do not overlap with this mutation:

Genomic Location:
Chromosome 18 (position 36696640)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTGTTCTCTCCAGTTTGTAAATAGGCAGTTTGTTTCGGAGAGCACGTA[T/G]AGTACTGGTGAAAAGGAGCAAAGAGAAGACTGGAGCGTGGAACCTGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rcb7s8i4