taar18a

Ensembl ID:
ENSDARG00000054254
ZFIN ID:
ZDB-GENE-100514-5
Human Orthologues:
TAAR5, TAAR6, TAAR8
Human Descriptions:
trace amine associated receptor 5 [Source:HGNC Symbol;Acc:30236]
trace amine associated receptor 6 [Source:HGNC Symbol;Acc:20978]
trace amine associated receptor 8 [Source:HGNC Symbol;Acc:14964]
Mouse Orthologues:
Taar5, Taar6, Taar7a, Taar7b, Taar7d, Taar7e, Taar7f, Taar8a, Taar8b, Taar8c, Taar9
Mouse Descriptions:
trace amine-associated receptor 5 Gene [Source:MGI Symbol;Acc:MGI:2685073]
trace amine-associated receptor 6 Gene [Source:MGI Symbol;Acc:MGI:2685074]
trace amine-associated receptor 7A Gene [Source:MGI Symbol;Acc:MGI:2685075]
trace amine-associated receptor 7B Gene [Source:MGI Symbol;Acc:MGI:3527438]
trace amine-associated receptor 7D Gene [Source:MGI Symbol;Acc:MGI:3527443]
trace amine-associated receptor 7E Gene [Source:MGI Symbol;Acc:MGI:3527445]
trace amine-associated receptor 7F Gene [Source:MGI Symbol;Acc:MGI:3527447]
trace amine-associated receptor 8A Gene [Source:MGI Symbol;Acc:MGI:2685076]
trace amine-associated receptor 8B Gene [Source:MGI Symbol;Acc:MGI:2685995]
trace amine-associated receptor 8C Gene [Source:MGI Symbol;Acc:MGI:3527452]
trace amine-associated receptor 9 Gene [Source:MGI Symbol;Acc:MGI:3527454]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41723 Nonsense Mutation detected in F1 DNA During 2016
sa41722 Nonsense Mutation detected in F1 DNA During 2016
sa21802 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030565 Nonsense 114 345 1 1
Genomic Location (Zv9):
Chromosome 10 (position 41890505)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40603214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCCGTCAAGTTGATTGAGACATGTTGGTATTTTGGAGACATTTTGTG[T/A]GACCTGTATATGATTATCATGGGACTTCTCCTCTCAGCATCTCTTAGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030565 Nonsense 306 345 1 1
Genomic Location (Zv9):
Chromosome 10 (position 41889929)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40602638
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATCTTCCACGATGAAAATTCTGATTTGGTCTTTGTACATTAACTCCTG[T/A]CTAAATCCTCTGATCTATGCTTTATTTTATCGCTGGTTTAAAATATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030565 Nonsense 312 345 1 1
Genomic Location (Zv9):
Chromosome 10 (position 41889911)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40602620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTGATTTGGTCTTTGTACATTAACTCCTGTCTAAATCCTCTGATCTA[T/A]GCTTTATTTTATCGCTGGTTTAAAATATCAGTTAAATGCGTCTTAACTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link