fbxl8

Ensembl ID:
ENSDARG00000054222
ZFIN ID:
ZDB-GENE-051120-81
Description:
F-box/LRR-repeat protein 8 [Source:RefSeq peptide;Acc:NP_001032499]
Human Orthologue:
FBXL8
Human Description:
F-box and leucine-rich repeat protein 8 [Source:HGNC Symbol;Acc:17875]
Mouse Orthologue:
Fbxl8
Mouse Description:
F-box and leucine-rich repeat protein 8 Gene [Source:MGI Symbol;Acc:MGI:1354697]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40905 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40905
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076386 Nonsense 291 334 2 2
ENSDART00000146019   None 12 None 1
Genomic Location (Zv9):
Chromosome 7 (position 30447849)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 28840191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAACTCAACTCTGAGCTGATAGTCTTAGCACAGCGGTGTGTCCGGCTC[C/T]AGGAGGTTCACTGTTATTGTGTGGTCTCGCAAGAAGTGATAACAGCCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link