LOC100002437

Ensembl ID:
ENSDARG00000054218
Human Orthologue:
GLTPD2
Human Description:
glycolipid transfer protein domain containing 2 [Source:HGNC Symbol;Acc:33756]
Mouse Orthologue:
Gltpd2
Mouse Description:
glycolipid transfer protein domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2444527]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11906 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11906
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076381 Nonsense 150 212 3 3
Genomic Location:
Chromosome 23 (position 45564361)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTGTGTCGCGAGGCCTACCTGGAGGTTCTGGCTCCKCATCATCCCTG[G/A]CTGGTGCAGCGCGCCGCTGAACTRGTGTTTCACGCAATGCCCGACCGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Metabolite levels: Novel Loci for metabolic networks and multi-tissue expression studies reveal genes for atherosclerosis. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hfkgqmu5