hectd1

Ensembl ID:
ENSDARG00000054213
ZFIN ID:
ZDB-GENE-030616-153
Description:
E3 ubiquitin-protein ligase HECTD1 [Source:RefSeq peptide;Acc:NP_001002504]
Human Orthologue:
HECTD1
Human Description:
HECT domain containing 1 [Source:HGNC Symbol;Acc:20157]
Mouse Orthologue:
Hectd1
Mouse Description:
HECT domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384768]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36435 Essential Splice Site Available for shipment Available now
sa36436 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36437 Nonsense Mutation detected in F1 DNA During 2016
sa17678 Essential Splice Site Available for shipment Available now
sa18554 Essential Splice Site Available for shipment Available now
sa28873 Essential Splice Site Mutation detected in F1 DNA During 2016
sa28874 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36438 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36435
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340 Essential Splice Site None 163 None 5
ENSDART00000076344 Essential Splice Site None 2576 None 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28729598)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28653525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAATTCTGTCCACCCTGTGTGTGTTTTCTCGTCGTTCGGCGATAAACGG[T/A]GAGTGTTTGTGTGTGTCGGCAGAGGGTTTGTGTCTCTGCTTCAGAGGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340   None 163 None 5
ENSDART00000076344 Essential Splice Site 386 2576 6 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28739849)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28663776
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACGCAGCAAAGACACCGATGCTCTCATTGATGCCATTGATACCGGTGG[T/A]AAGTGTTCATATAGTGCATATTAATATGATAAAGTTAATATTTGGTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36437
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340   None 163 None 5
ENSDART00000076344 Nonsense 554 2576 11 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28741493)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28665420
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTTTACAGGAAAGCTAGTTTAGCTCTGATCAGAAAAATGGTGCACTA[C/A]AGTTCTGAAGTTCTGCTTAAGGAAGTGTGTGATTCTGATGCTGGACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340   None 163 None 5
ENSDART00000076344 Essential Splice Site 958 2576 18 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28744148)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28668075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATAAATGTGTTCAAGACTGCATTCACTGAAAATGAAGATGACGAAAGG[T/C]AAACTGTATATTATGTTCCACTTGAACGGTTTGTGTTTTTGTTGGGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340   None 163 None 5
ENSDART00000076344 Essential Splice Site 993 2576 19 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28744419)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28668346
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTACCTTTGCAYTTRTATGATACCCCAGGCTCAACAWATAATTTACAG[G/T]TCAGTCTYCATCTTTGCAGATGTATTTTTAGTTTAGAACWTTTTTAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28873
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340   None 163 None 5
ENSDART00000076344 Essential Splice Site 1856 2576 None 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28751888)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28675815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATAGAGAATTGAAGGATTCCGACAAAGAAAGAGAGAGCGGAAAGATGG[T/G]AATAGCACATTTTTTAACATCTCTTCTCCTCTCAATCTCTCTTCCTATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340   None 163 None 5
ENSDART00000076344 Essential Splice Site 2016 2576 33 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28753154)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28677081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATTCACCAGCAAAAAAATTACAACCAAAATCCTGCAGCAGATTGAAG[T/A]AATTTGACATGTTTTAATTATGCATTGGTTATTTGTTGTAGATTCAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36438
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340   None 163 None 5
ENSDART00000076344 Nonsense 2254 2576 37 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 28755213)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 28679140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGCTCTGTATGGGTGACATCAAAAGCAACATGAGTAAGCTACTTTA[T/A]CAAACCCGTGGTGAGTCGGACTGTCACTTCTCTGAAATCCAGTCTGAGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link