hectd1

Ensembl ID:
ENSDARG00000054213
ZFIN ID:
ZDB-GENE-030616-153
Description:
E3 ubiquitin-protein ligase HECTD1 [Source:RefSeq peptide;Acc:NP_001002504]
Human Orthologue:
HECTD1
Human Description:
HECT domain containing 1 [Source:HGNC Symbol;Acc:20157]
Mouse Orthologue:
Hectd1
Mouse Description:
HECT domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2384768]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17678 Essential Splice Site Available for shipment Available now
sa18554 Essential Splice Site Available for shipment Available now
sa4715 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340 None None 163 None 5
ENSDART00000076344 Essential Splice Site 958 2576 18 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 28744148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATAAATGTGTTCAAGACTGCATTCACTGAAAATGAAGATGACGAAAGG[T/C]AAACTGTATATTATGTTCCACTTGAACGGTTTGTGTTTTTGTTGGGCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18554
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340 None None 163 None 5
ENSDART00000076344 Essential Splice Site 993 2576 19 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 28744419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTACCTTTGCAYTTRTATGATACCCCAGGCTCAACAWATAATTTACAG[G/T]TCAGTCTYCATCTTTGCAGATGTATTTTTAGTTTAGAACWTTTTTAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4715
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076340 None None 163 None 5
ENSDART00000076344 Essential Splice Site 1038 2576 20 42

The following transcripts of ENSDARG00000054213 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 28744664)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCCGCTGGCCACTGTTGAGTCACTTGAGCAGTATCTGCTCAAGATGG[T/C]AGGATGTTGTCTCNNNNTTTTTTCCTATTATTCTATATTGACTCATTTGTATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yscot53k