phkg2

Ensembl ID:
ENSDARG00000054208
ZFIN ID:
ZDB-GENE-040426-825
Description:
phosphorylase b kinase gamma catalytic chain, testis/liver isoform [Source:RefSeq peptide;Acc:NP_95
Human Orthologue:
PHKG2
Human Description:
phosphorylase kinase, gamma 2 (testis) [Source:HGNC Symbol;Acc:8931]
Mouse Orthologue:
Phkg2
Mouse Description:
phosphorylase kinase, gamma 2 (testis) Gene [Source:MGI Symbol;Acc:MGI:1916211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu7862 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
hu7862
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076362 Essential Splice Site None 390 2 10
Genomic Location (Zv9):
Chromosome 12 (position 30440625)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28777562
KASP Assay ID:
554-2378.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCTCCTCCCTCATTCAAATCAATATAAATAAATGTGTCTGTGTTTTA[A/G]GAATTCAGCATGACTCGTGATATCGTTCTTGGAGATGAACTACCTGACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link