npffr1l1

Ensembl ID:
ENSDARG00000054203
ZFIN ID:
ZDB-GENE-091118-18
Description:
hypothetical protein LOC559950 [Source:RefSeq peptide;Acc:NP_001165167]
Human Orthologue:
NPFFR1
Human Description:
neuropeptide FF receptor 1 [Source:HGNC Symbol;Acc:17425]
Mouse Orthologue:
Npffr1
Mouse Description:
neuropeptide FF receptor 1 Gene [Source:MGI Symbol;Acc:MGI:2685082]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41730 Nonsense Mutation detected in F1 DNA During 2017
sa21809 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41730
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076359 Nonsense 15 398 1 3
ENSDART00000143516   None 306 None 3
Genomic Location (Zv9):
Chromosome 10 (position 42330801)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41043510
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCGAGATGGACACAATGACCCTCAACCACTCTGCTGCCAACCTGAGCT[G/A]GCAAAACTGCACACTGTTGCCGTATTACATCCACTCGGCGGGGATGGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076359 Nonsense 38 398 1 3
ENSDART00000143516 Nonsense 23 306 1 3
Genomic Location (Zv9):
Chromosome 10 (position 42330731)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41043440
KASP Assay ID:
2260-3653.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTATTACATCCACTCGGCGGGGATGGCGGTCAGCTACATCCTCTCGTA[T/A]CTGCTGGTGTTGCTGCTGTGTGTGGTGGGCAACGGGCTGGTCTGTCTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link