rnf40

Ensembl ID:
ENSDARG00000054201
ZFIN ID:
ZDB-GENE-030131-6607
Description:
Novel protein (Zgc:171713) [Source:UniProtKB/TrEMBL;Acc:Q7T178]
Human Orthologue:
RNF40
Human Description:
ring finger protein 40 [Source:HGNC Symbol;Acc:16867]
Mouse Orthologue:
Rnf40
Mouse Description:
ring finger protein 40 Gene [Source:MGI Symbol;Acc:MGI:2142048]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35311 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35311
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076342 Splice Site, Nonsense 898 990 22 24
ENSDART00000076346   None 575 None 12
ENSDART00000076355 Splice Site, Nonsense 493 558 13 17
ENSDART00000076572   None 331 None 7
ENSDART00000137069   None 529 None 10
ENSDART00000145221 Splice Site, Nonsense 337 429 6 8
Genomic Location (Zv9):
Chromosome 12 (position 30478635)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28815572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGACAACCGCACCGCCCGTGAGAGGGAGAGTGTCAACCTCAAGAAAGCA[C/T]AGGTACATGGGCATGCGTGTTGTAGATGTGTTTGGGATACAGATGAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link