LOC795255

Ensembl ID:
ENSDARG00000054196
Human Orthologue:
SLC38A8
Human Description:
solute carrier family 38, member 8 [Source:HGNC Symbol;Acc:32434]
Mouse Orthologue:
Slc38a8
Mouse Description:
solute carrier family 38, member 8 Gene [Source:MGI Symbol;Acc:MGI:2685433]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25363 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25363
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076345 Nonsense 325 444 7 10
Genomic Location:
Chromosome 7 (position 30510841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTGTTTGGAATTTCGATCGTCACCATCTATCCTATAATACTGCTGT[T/A]GGGAAGGTACTGTAAACCACAAATATGTGCCTTACTCACTGCATGTACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/falq24jj