pgrmc1

Ensembl ID:
ENSDARG00000054172
ZFIN ID:
ZDB-GENE-041114-91
Description:
membrane-associated progesterone receptor component 1 [Source:RefSeq peptide;Acc:NP_001007393]
Human Orthologue:
PGRMC1
Human Description:
progesterone receptor membrane component 1 [Source:HGNC Symbol;Acc:16090]
Mouse Orthologue:
Pgrmc1
Mouse Description:
progesterone receptor membrane component 1 Gene [Source:MGI Symbol;Acc:MGI:1858305]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37360 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37360
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076328 Essential Splice Site 149 179 2 3
Genomic Location (Zv9):
Chromosome 21 (position 36763835)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 37753184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCCATGCAGCAGGAGAGCCTGAGCGAGTGGGAGACCCAGTTCACACG[T/C]GAGTTGAAGGACACTACACATTTTGCACATTTGATTTTCTGGGCCAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link