pcna

Ensembl ID:
ENSDARG00000054155
ZFIN ID:
ZDB-GENE-000210-8
Description:
Proliferating cell nuclear antigen [Source:UniProtKB/Swiss-Prot;Acc:Q9PTP1]
Human Orthologue:
PCNA
Human Description:
proliferating cell nuclear antigen [Source:HGNC Symbol;Acc:8729]
Mouse Orthologue:
Pcna
Mouse Description:
proliferating cell nuclear antigen Gene [Source:MGI Symbol;Acc:MGI:97503]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8962 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000076304 Essential Splice Site 194 260 4 6
Genomic Location (Zv9):
Chromosome 10 (position 42190530)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 40903239
KASP Assay ID:
2260-3649.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACATCAAGCTCTCACAGACCAGCAAYGTCGACAAGGAGGATGAAGCGG[T/G]AACATACTATTCATTTAAGGCTGCACGATACTGGGAAAAATATGCAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link